circad | circRNAs associated with diseases

Circular RNA 100146
Gene	n/a	Organism	Human
Genome Locus	chr1:32691771-32692131:+	Build	hg19
Disease	Non small cell Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	30665425
Experimental Method
Sample Type	Tissue and cell lines	Comparison	40 pairs of matched NSCLC cancer and adjacent tissue samples and cell lines
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GAGCTCAACCAGTATAGTGCC Reverse ACATGATGATGTTGCCCCCAA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Chen, L, Nan, A, Zhang, N, Jia, Y, Li, X, Ling, Y, Dai, J, Zhang, S, Yang, Q, Yi, Y, Jiang, Y (2019). Circular RNA 100146 functions as an oncogene through direct binding to miR-361-3p and miR-615-5p in non-small cell lung cancer. Mol. Cancer, 18, 1:13.